DNA extraction

CTAB method for DNA extraction

  • heat water bath to 65°C (can be 60–74°C).
  • for grinding up the specimens, there are a few options:

A. You can grind the sample dry by putting the sample in an Eppendorf tube, and dipping the end of the tube in liquid nitrogen until the sample freezes (the tube won’t crack, and it takes about 10 seconds for the end of the tube/specimen to freeze) – cool down a pellet pestle as well (see http://www.kontes.com/html/pg-749520-0090.html, catalogue number 749521-1500 or equivalent), then just grind it up while frozen until it’s a fine powder (takes about 10–30 seconds). Then add 500 μL of CTAB extraction buffer, mix, and incubate for 10 minutes at 65°C.

B. Alternatively you can heat up 500 μL of CTAB extraction buffer in a new tube, and then add the sample to the buffer and grind it while it’s hot, then return to the water bath for 10 minutes at 65°C.

C. Third option (which I must admit I usually do) is to just grind the sample in CTAB buffer at room temperature and then put it into the water bath for 10 minutes at 65°C.

  • While incubating, invert the tubes a few times during the ten minutes to mix them. If I’m doing a number of samples (which is most of the time), I grind them up and put them in the water bath, and then once they’re all done I leave them for 10 minutes after the last sample went in. It means that the first sample gets longer in the water bath than the last—I’ve never found this to make any difference.
  • spin at 12000 G for 5 minutes.
  • transfer supernatent to a clean tube and add an equal volume of chloroform and mix (don’t vortex) to emulsify.
  • spin at 12000 G for 5 minutes.
  • transfer aqueous (upper) layer to a clean tube and add another equal volume of chloroform and mix (it’ll be pretty clean at this stage and will settle out quickly).
  • spin at 12000 G for 3–5 minutes.
  • transfer aqueous (upper) layer to a clean tube and add two volumes of 95% ethanol and 1/10 volume of 3 M sodium acetate pH 5.2. (e.g., if you’ve got 400 μL of solution left after the last chloroform extraction, add 800 μL of ethanol and 40 μL of sodium acetate). Tilt the tube back and forth – you might be able to see DNA precipitate out at this stage. Mix it gently until the sodium acetate and ethanol have mixed properly. If you’re brave and you’ve got a decent amount of DNA, you can ‘hook’ the DNA out at this stage and transfer it (using a yellow pipette tip) into a clean tube containing 70% ethanol. Wash it twice in 70% ethanol, dry and re-suspend in 50 μL of TE buffer (I usually leave overnight in the fridge at this stage to ensure the DNA is dissolved).
  • If there’s no obvious DNA (or if there is only a little and you aren’t brave enough to scoop it out, or if you just feel like doing it this way) incubate the tube at room temperature for 30 minutes, then spin at 12000 G for 15 minutes. This almost always gives at least a small pellet, which will contain enough DNA for PCR etc. Wash pellet twice in about 500 μL 70% ethanol, dry, and dissolve in 50 μL TE buffer (again, leave overnight if necessary).

You want to make sure the 70% ethanol really is 70%. If it falls below this (due to evaporation of the ethanol over time), then the DNA might dissolve in the ethanol and you’ll loose it. Some people use 80% ethanol instead, to ensure that the pellet stays solid. The disadvantage of this is that the salt is not quite so efficiently removed – but I’ve used both 70% and 80% and found it works OK both ways.

  • The next morning, add 1 μL RNAase (Roche RNase, DNA-free – Catalogue number 1119915) and incubate at 37°C for 15 minutes. I find this improves PCR success a lot.
  • refrigerate or freeze sample until ready for PCR.

To make CTAB isolation buffer, add:

2.0 g CTAB (hexadecyl-trimethyl-ammonium bromide)

28 mL of 5M NaCl (make this as a stock solution)

4 mL of 0.5M EDTA (make this as a stock solution)

1 g PEG 8000

10 mL of 1M Tris-HCl (make this as a stock solution)

and make to 100 mL volume with water. I usually add most of the water, then dissolve it on a magnetic stirrer for a while (few hours), then transfer to a volumetric flask and make up to 100 mL.

CTAB buffer recipe from:

Carlson JE, Tulsieram LK, Glaubitz JC, Luk VMK, Kauffeldt CRR 1991. Segregation of random amplified DNA markers in F1 progeny of conifers. Theoretical and Applied Genetics 83, 194–200.

Primer sequences

Primer sequences

Primer name Sequence (5′–3′) Length Tm (°C) Source
AM1 GTTTCCCGTAAGGCGCCGAA 20 56
ITS1 TCCGTAGGTGAACCTGCGG 19 65 White et al. 1990
ITS1-F CTTGGTCATTTAGAGGAAGTAA 22
ITS2 GCTGCGTTCTTCATCGATGC 20 62 White et al. 1990
ITS3 GCATCGATGAAGAACGCAGC 20 62 White et al. 1990
ITS4 TCCTCCGCTTATTGATATGC 20 58 White et al. 1990
ITS5 GGAAGTAAAAGTCGTAACAAGG 22 63
NS1 GTAGTCATATGCTTGTCTC 19 47
NS31 TTGGAGGGCAAGTCTGGTGCC 21 58
PN3 CCGTTGGTGAACCAGCGGAGGGATC 25 Viaud et al. 2000
PN10 TCCGCTTATTGATATGCTTAAG 22 Viaud et al. 2000
PN34 TTGCCGCTTCACTCGCCGTT 20 Viaud et al. 2000
Taberlet ‘a’ CATTACAAATGCGATGCTCT 20 Taberlet et al. 1991
Taberlet ‘b’ TCTACCGATTTCGCCATATC 20 Taberlet et al. 1991
Taberlet ‘c’ CGAAATCGGTAGACGCTACG 20 Taberlet et al. 1991
Taberlet ‘d’ GGGGATAGAGGGACTTGAAC 20 Taberlet et al. 1991
Taberlet ‘e’ GGTTCAAGTCCCTCTATCCC 20 Taberlet et al. 1991
Taberlet ‘f’ ATTTGAACTGGTGACACGAG 20 Taberlet et al. 1991
ISSR Primers
7 = (CT)8-RG CTCTCTCTCTCTCTCTRG web
901 = (GT)6-YR GTGTGTGTGTGTYR web
TERRY = (GTG)4-RC GTGGTGGTGGTGRC web
814 = (CT)8-TG CTCTCTCTCTCTCTCTTG web
902 = (GT)6-AY GTGTGTGTGTGTAY web
MAO = (CTC)4-RC CTCCTCCTCCTCRC web
843 = (CT)8-RA CTCTCTCTCTCTCTCTRA web
AW3 = (GT)6-RG GTGTGTGTGTGTRG web
MANNY = (CAC)4-RC CACCACCACCACRC web
844 = (CT)8-RC CTCTCTCTCTCTCTCTRC web
M1 = CAA-(GA)5 CAAGAGAGAGAGA web
GOOFY = (GT)7-YG GTGTGTGTGTGTGTYG web
898 = (CA)6-RY CACACACACACARY web
M2 = GGGC-(GA)8 GGGCGAGAGAGAGAGAGAGA web
BECKY = (CA)7-YC CACACACACACACAYC web
899 = (CA)6-RG CACACACACACARG web
OMAR = (GAG)4-RC GAGGAGGAGGAGRC web
CHRIS = (CA)7-YG CACACACACACACAYG web
JOHN = (AG)7-YC AGAGAGAGAGAGAGYC web
DAT = (GA)7-RG GAGAGAGAGAGAGARG web

References

Taberlet P, Gielly L, Pautou G, Bouvet J 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17, 1105–1109.

Viaud M, Pasquier A, Brygoo Y 2000. Diversity of soil fungi studied by PCR-RFLP of ITS. Mycological Research 104, 1027–1032.

White TJ, Bruns T, Lee S, Taylor J 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications pp. 315–322.