Primer sequences

Primer sequences

Primer name Sequence (5′–3′) Length Tm (°C) Source
AM1 GTTTCCCGTAAGGCGCCGAA 20 56
ITS1 TCCGTAGGTGAACCTGCGG 19 65 White et al. 1990
ITS1-F CTTGGTCATTTAGAGGAAGTAA 22
ITS2 GCTGCGTTCTTCATCGATGC 20 62 White et al. 1990
ITS3 GCATCGATGAAGAACGCAGC 20 62 White et al. 1990
ITS4 TCCTCCGCTTATTGATATGC 20 58 White et al. 1990
ITS5 GGAAGTAAAAGTCGTAACAAGG 22 63
NS1 GTAGTCATATGCTTGTCTC 19 47
NS31 TTGGAGGGCAAGTCTGGTGCC 21 58
PN3 CCGTTGGTGAACCAGCGGAGGGATC 25 Viaud et al. 2000
PN10 TCCGCTTATTGATATGCTTAAG 22 Viaud et al. 2000
PN34 TTGCCGCTTCACTCGCCGTT 20 Viaud et al. 2000
Taberlet ‘a’ CATTACAAATGCGATGCTCT 20 Taberlet et al. 1991
Taberlet ‘b’ TCTACCGATTTCGCCATATC 20 Taberlet et al. 1991
Taberlet ‘c’ CGAAATCGGTAGACGCTACG 20 Taberlet et al. 1991
Taberlet ‘d’ GGGGATAGAGGGACTTGAAC 20 Taberlet et al. 1991
Taberlet ‘e’ GGTTCAAGTCCCTCTATCCC 20 Taberlet et al. 1991
Taberlet ‘f’ ATTTGAACTGGTGACACGAG 20 Taberlet et al. 1991
ISSR Primers
7 = (CT)8-RG CTCTCTCTCTCTCTCTRG web
901 = (GT)6-YR GTGTGTGTGTGTYR web
TERRY = (GTG)4-RC GTGGTGGTGGTGRC web
814 = (CT)8-TG CTCTCTCTCTCTCTCTTG web
902 = (GT)6-AY GTGTGTGTGTGTAY web
MAO = (CTC)4-RC CTCCTCCTCCTCRC web
843 = (CT)8-RA CTCTCTCTCTCTCTCTRA web
AW3 = (GT)6-RG GTGTGTGTGTGTRG web
MANNY = (CAC)4-RC CACCACCACCACRC web
844 = (CT)8-RC CTCTCTCTCTCTCTCTRC web
M1 = CAA-(GA)5 CAAGAGAGAGAGA web
GOOFY = (GT)7-YG GTGTGTGTGTGTGTYG web
898 = (CA)6-RY CACACACACACARY web
M2 = GGGC-(GA)8 GGGCGAGAGAGAGAGAGAGA web
BECKY = (CA)7-YC CACACACACACACAYC web
899 = (CA)6-RG CACACACACACARG web
OMAR = (GAG)4-RC GAGGAGGAGGAGRC web
CHRIS = (CA)7-YG CACACACACACACAYG web
JOHN = (AG)7-YC AGAGAGAGAGAGAGYC web
DAT = (GA)7-RG GAGAGAGAGAGAGARG web

References

Taberlet P, Gielly L, Pautou G, Bouvet J 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17, 1105–1109.

Viaud M, Pasquier A, Brygoo Y 2000. Diversity of soil fungi studied by PCR-RFLP of ITS. Mycological Research 104, 1027–1032.

White TJ, Bruns T, Lee S, Taylor J 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications pp. 315–322.

Leave a Reply

Your email address will not be published. Required fields are marked *